Feedback Form
{pdb_id}

Ordered Portions of Nucleic Acid

This page is currently not being updated!

Sequences in red contain non-standard nucleotides.
Click on the virus name to see an image.
Virus Name

RNA/DNA

Sequence

# Nucleotides

PDB ID

1. Bromoviridae
Cowpea Chlorotic Mottle Virus (CCMV)RNAR(AUAU), T(AU)R(4), T(2)1cwp
Tomoto Aspermy VirusRNAR(AAA)R(3)1laj
2. Comoviridae
Bean Pod Mottle Virus, Middle ComponentRNAR(AGUCUC)R(6)1pgl
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTIONRNAR()R(0)1bmv
3. Leviviridae
Bacteriophage MS2 Mutant (T59S)/RNA OperatorRNAR(ACAUGAGGAUUACCCAUGU)R(19)1aq3
Bacteriophage MS2 Mutant (T45A)/RNA OperatorRNAR(ACAUGAGGAUUACCCAUGU)R(19)1aq4
MS2-RNA HAIRPIN (A-5) COMPLEXRNAS(ACAUGAGGAUAACCCAUGU)S(19)2c50
Bacteriophage MS2/RNA Hairpin (4One-5)RNAR(ACAUGAGGA(ONE)UACCCAUGU)R(19)1dzs
Bacteriophage MS2/RNA Hairpin (5Bru-5)RNAR(ACAUGAGGAUUACCCAUGU)R(19)1e6t
Bacteriophage MS2/RNA Hairpin (2One-5)RNAR(ACAUGAGGAU(PYO)ACCCAUGU)R(19)1e7x
Bacteriophage MS2/RNA Hairpin (C-7)RNAR(ACAUGAGGCUCACCCAUGU)R(19)1gkv
Bacteriophage MS2/RNA Hairpin (G-10)RNAR(ACAUCGCGAUUACGGAUGU)R(19)1gkw
Bacteriophage MS2/RNA Hairpin (G-5)RNAR(ACAUGAGGAUGACCCAUGU)R(19)1h8j
Bacteriophage MS2/RNA Hairpin (Ade-5)RNAR(ACAUGAGGAUAACCCAUGU)R(19)1he6
Bacteriophage MS2/RNA Hairpin (C-10)RNAR(ACAUGCGGAUCACCCAUGU)R(19)1kuo
Bacteriophage MS2/19 nt. MS2 RNA FragmentRNAR(ACAUGAGGAUCACCCAUGU)R(19)1zdh
Bacteriophage MS2/19 nt. MS2 RNA FragmentRNAR(ACAUGAGGAUUACCCAUGU)R(19)1zdi
Bacteriophage MS2/8 nt. MS2 RNA FragmentRNAR(GGAUCACC)R(8)1zdj
Bacteriophage MS2/23 nt. MS2 RNA FragmentRNAR(ACAUGAGGAUCACCCAUGU)R(19)1zdk
Bacteriophage MS2/RNA Aptamer F5RNAR(CCGGAGGAUCACCACGGG)R(18)5msf
Bacteriophage MS2/RNA Aptamer F6RNAR(CCACAGUCACUGGG), S(CAGUCACUGG)R(14), S(10)6msf
Bacteriophage MS2/RNA Aptamer F7RNAR(UCGCCAACAGGCGG)R(14)7msf
Bacteriophage MS2/RNA Aptamer F5 (2-aminopurine at -10 pos.)DNAR(CCGG(2PR)GGAUCACCACGG)R(17)1u1y
Bacteriophage MS2/RNA Hairpin (5bru-5) ComplexRNAR(CAUGAGGAU(5BU)ACCCAUG)R(17)2bu1
MS2-RNA HAIRPIN (2THIOURACIL-5) COMPLEXRNAS(ACAUGAGGAU(SUR)ACCCAUGU)S(19)2c4y
MS2-RNA HAIRPIN (G-5) COMPLEXRNAS(ACAUGAGGAUGACCCAUGU)S(19)2c51
MS2 Wild-type RNA stemloop complexed with an N87S mutant MS2 capsidRNAS(ACAUGAGGAUUACCCAUGU)S(19)2b2g
RNA stemloop operator from bacteriophage QBETA complexed with an N87S,E89K mutant MS2 capsidRNAS(AUGCAUGUCUAAGACAGCAU)S(20)2b2d
RNA stemloop from bacteriophage Qbeta complexed with an N87S mutant MS2 CapsidRNAR(AUGCAUGUCUAAGACAGCAU)R(20)1zse
MS2-RNA HAIRPIN (2SU-5-6) COMPLEXRNAS(ACAUGAGGA(SUR)(SUR)ACCCAUGU)S(19)2c4z
RNA stemloop from bacteriophage MS2 complexed with an N87S,E89K mutant MS2 capsidRNAS(ACAUGAGGAUUACCCAUGU)S(19)2b2e
SMALL RNA PHAGE PRR1 IN COMPLEX WITH AN RNA OPERATOR FRAGMENRNAS()S(0)4ang
4. Microviridae
Bacteriophage α3DNAX(CCCC)X(4)1m06
Φ-X 174 DNA binding protein JDNAX(CAAA)X(4)1rb8
Bacteriophage Φ-X 174DNAN(AAAAC)N(5)2bpa
5. NA
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTIONRNAR()R(0)2jun
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTIONRNAA()A(0)1jun
6. Nodaviridae
Crystal structure of Flock House N363T mutantRNAR(CCUCUUUUAUCU)R(12)2q23
Pariacoto Virus (PAV)RNAR(UUUUUUUUUUUUUAAAAUUUUUUUU)R(25)1f8v
Black Beetle Virus (BBV)RNAR(UCUUAUAUCU)R(10)2bbv
Flock House VirusRNAR(UCUUUUAUCU)R(10)fhv
Flock House Virus Coat protein D75N mutantRNAR(CCUCUUUUAUCU)R(12)2q25
FHV VIRUS LIKE PARTICLERNAR()R(0)2q26
CRYSTAL STRUCTURE OF FLOCK HOUSE VIRUSRNAR()R(0)2z2q
Crystal Structure of Flock House Virus calcium mutantRNAR(UUUAUCUP)R(8)3lob
CRYSTAL STRUCTURE OF THE N363T MUTANT OF THE FLOCK HOUSE VIRRNAR()R(0)4fts
Crystal structure of the D75N mutant capsid of Flock House virusRNAD(UUUCUCUUUUAUCUU)D(15)4fte
CRYSTAL STRUCTURE OF THE VIRUS LIKE PARTICLE OF FLOCK HOUSERNAR()R(0)4fsj
CRYSTAL STRUCTURE OF THE AUTHENTIC FLOCK HOUSE VIRUS PARTICLRNAR()R(0)4ftb
7. Parvoviridae
Canine Parvovirus Strain D, Mutant A300DDNAR(CCACCCCAA), S(AC)R(9), S(2)1ijs
Mice Minute Virus (MVM), Strain IDNAR(CCACCCCAACA), S(CAAA), T(A)R(11), S(4), T(1)1mvm
Canine ParvovirusDNAR(NTACCTCTTGC)R(11)1p5w
Canine Parvovirus Strain DDNAN(ATACCTCTTGC)N(11)4dpv
8. Satellites
Satellite Tobacco Mosaic VirusRNAR(AAAAAAAAAA), S(UUUUUUUUUU), T(U)R(10), S(10), T(1)1a34
9. Tetraviridae
CRYSTAL STRUCTURE OF AUTHENTIC PROVIDENCE VIRUSRNAR()R(0)2qqp
10. Tymoviridae
Desmodium Yellow Mottle Virus (DYMV)RNAR(UUUUUUU), S(UU)R(7), S(2)1ddl
Structure of Turnip Yellow Mosaic Virus at 100 KRNAD(CCC)D(3)2fz2
CRYSTAL STRUCTURE OF PHYSALIS MOTTLE VIRUS WITH INTACT ORDERED RNARNAD(CCC)D(3)2xpj

Stereo pictures: (click images to enlarge)


Cowpea Chlorotic Mottle Virus (CCMV)
Cowpea Chlorotic Mottle Virus (CCMV)

Cowpea Chlorotic Mottle Virus (CCMV) stereo
Top of page
Tomoto Aspermy Virus
Tomoto Aspermy Virus

Tomoto Aspermy Virus stereo
Top of page
Bean Pod Mottle Virus, Middle Component
Bean Pod Mottle Virus, Middle Component

Bean Pod Mottle Virus, Middle Component stereo
Top of page
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION

PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION stereo
Top of page
MS2-RNA HAIRPIN (G-5) COMPLEX
MS2-RNA HAIRPIN (G-5) COMPLEX

MS2-RNA HAIRPIN (G-5) COMPLEX stereo
Top of page
Bacteriophage MS2/RNA Hairpin (Ade-5)
Bacteriophage MS2/RNA Hairpin (Ade-5)

Bacteriophage MS2/RNA Hairpin (Ade-5) stereo
Top of page
Bacteriophage MS2/RNA Aptamer F5
Bacteriophage MS2/RNA Aptamer F5

Bacteriophage MS2/RNA Aptamer F5 stereo
Top of page
Bacteriophage MS2/RNA Hairpin (4One-5)
Bacteriophage MS2/RNA Hairpin (4One-5)

Bacteriophage MS2/RNA Hairpin (4One-5) stereo
Top of page
Bacteriophage MS2/19 nt. MS2 RNA Fragment
Bacteriophage MS2/19 nt. MS2 RNA Fragment

Bacteriophage MS2/19 nt. MS2 RNA Fragment stereo
Top of page
RNA stemloop operator from bacteriophage QBETA complexed with an N87S,E89K mutant MS2 capsid
RNA stemloop operator from bacteriophage QBETA complexed with an N87S,E89K mutant MS2 capsid

RNA stemloop operator from bacteriophage QBETA complexed with an N87S,E89K mutant MS2 capsid stereo
Top of page
Bacteriophage MS2/RNA Hairpin (C-10)
Bacteriophage MS2/RNA Hairpin (C-10)

Bacteriophage MS2/RNA Hairpin (C-10) stereo
Top of page
Bacteriophage MS2/RNA Aptamer F7
Bacteriophage MS2/RNA Aptamer F7

Bacteriophage MS2/RNA Aptamer F7 stereo
Top of page
RNA stemloop from bacteriophage MS2 complexed with an N87S,E89K mutant MS2 capsid
RNA stemloop from bacteriophage MS2 complexed with an N87S,E89K mutant MS2 capsid

RNA stemloop from bacteriophage MS2 complexed with an N87S,E89K mutant MS2 capsid stereo
Top of page
Bacteriophage MS2/RNA Hairpin (2One-5)
Bacteriophage MS2/RNA Hairpin (2One-5)

Bacteriophage MS2/RNA Hairpin (2One-5) stereo
Top of page
Bacteriophage MS2/8 nt. MS2 RNA Fragment
Bacteriophage MS2/8 nt. MS2 RNA Fragment

Bacteriophage MS2/8 nt. MS2 RNA Fragment stereo
Top of page
SMALL RNA PHAGE PRR1 IN COMPLEX WITH AN RNA OPERATOR FRAGMEN
SMALL RNA PHAGE PRR1 IN COMPLEX WITH AN RNA OPERATOR FRAGMEN

SMALL RNA PHAGE PRR1 IN COMPLEX WITH AN RNA OPERATOR FRAGMEN stereo
Top of page
Bacteriophage MS2 Mutant (T45A)/RNA Operator
Bacteriophage MS2 Mutant (T45A)/RNA Operator

Bacteriophage MS2 Mutant (T45A)/RNA Operator stereo
Top of page
Bacteriophage MS2/RNA Aptamer F5 (2-aminopurine at -10 pos.)
Bacteriophage MS2/RNA Aptamer F5 (2-aminopurine at -10 pos.)

Bacteriophage MS2/RNA Aptamer F5 (2-aminopurine at -10 pos.) stereo
Top of page
Bacteriophage MS2/RNA Hairpin (C-7)
Bacteriophage MS2/RNA Hairpin (C-7)

Bacteriophage MS2/RNA Hairpin (C-7) stereo
Top of page
MS2-RNA HAIRPIN (2SU-5-6) COMPLEX
MS2-RNA HAIRPIN (2SU-5-6) COMPLEX

MS2-RNA HAIRPIN (2SU-5-6) COMPLEX stereo
Top of page
MS2-RNA HAIRPIN (2THIOURACIL-5) COMPLEX
MS2-RNA HAIRPIN (2THIOURACIL-5) COMPLEX

MS2-RNA HAIRPIN (2THIOURACIL-5) COMPLEX stereo
Top of page
Bacteriophage MS2/RNA Hairpin (G-5)
Bacteriophage MS2/RNA Hairpin (G-5)

Bacteriophage MS2/RNA Hairpin (G-5) stereo
Top of page
MS2 Wild-type RNA stemloop complexed with an N87S mutant MS2 capsid
MS2 Wild-type RNA stemloop complexed with an N87S mutant MS2 capsid

MS2 Wild-type RNA stemloop complexed with an N87S mutant MS2 capsid stereo
Top of page
Bacteriophage MS2/RNA Aptamer F6
Bacteriophage MS2/RNA Aptamer F6

Bacteriophage MS2/RNA Aptamer F6 stereo
Top of page
Bacteriophage MS2/RNA Hairpin (5Bru-5)
Bacteriophage MS2/RNA Hairpin (5Bru-5)

Bacteriophage MS2/RNA Hairpin (5Bru-5) stereo
Top of page
Bacteriophage MS2/19 nt. MS2 RNA Fragment
Bacteriophage MS2/19 nt. MS2 RNA Fragment

Bacteriophage MS2/19 nt. MS2 RNA Fragment stereo
Top of page
RNA stemloop from bacteriophage Qbeta complexed with an N87S mutant MS2 Capsid
RNA stemloop from bacteriophage Qbeta complexed with an N87S mutant MS2 Capsid

RNA stemloop from bacteriophage Qbeta complexed with an N87S mutant MS2 Capsid stereo
Top of page
Bacteriophage MS2 Mutant (T59S)/RNA Operator
Bacteriophage MS2 Mutant (T59S)/RNA Operator

Bacteriophage MS2 Mutant (T59S)/RNA Operator stereo
Top of page
Bacteriophage MS2/23 nt. MS2 RNA Fragment
Bacteriophage MS2/23 nt. MS2 RNA Fragment

Bacteriophage MS2/23 nt. MS2 RNA Fragment stereo
Top of page
MS2-RNA HAIRPIN (A-5) COMPLEX
MS2-RNA HAIRPIN (A-5) COMPLEX

MS2-RNA HAIRPIN (A-5) COMPLEX stereo
Top of page
Bacteriophage MS2/RNA Hairpin (5bru-5) Complex
Bacteriophage MS2/RNA Hairpin (5bru-5) Complex

Bacteriophage MS2/RNA Hairpin (5bru-5) Complex stereo
Top of page
Bacteriophage MS2/RNA Hairpin (G-10)
Bacteriophage MS2/RNA Hairpin (G-10)

Bacteriophage MS2/RNA Hairpin (G-10) stereo
Top of page
Bacteriophage α3
Bacteriophage α3

Bacteriophage α3 stereo
Top of page
Φ-X 174 DNA binding protein J
Φ-X 174 DNA binding protein J

Φ-X 174 DNA binding protein J stereo
Top of page
Bacteriophage Φ-X 174
Bacteriophage Φ-X 174

Bacteriophage Φ-X 174 stereo
Top of page
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION

PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION stereo
Top of page
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION
PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION

PROTEIN-/RNA$ INTERACTIONS IN AN ICOSAHEDRAL VIRUS AT 3.0 ANGSTROMS RESOLUTION stereo
Top of page
CRYSTAL STRUCTURE OF THE N363T MUTANT OF THE FLOCK HOUSE VIR
CRYSTAL STRUCTURE OF THE N363T MUTANT OF THE FLOCK HOUSE VIR

CRYSTAL STRUCTURE OF THE N363T MUTANT OF THE FLOCK HOUSE VIR stereo
Top of page
CRYSTAL STRUCTURE OF THE VIRUS LIKE PARTICLE OF FLOCK HOUSE
CRYSTAL STRUCTURE OF THE VIRUS LIKE PARTICLE OF FLOCK HOUSE

CRYSTAL STRUCTURE OF THE VIRUS LIKE PARTICLE OF FLOCK HOUSE stereo
Top of page
CRYSTAL STRUCTURE OF FLOCK HOUSE VIRUS
CRYSTAL STRUCTURE OF FLOCK HOUSE VIRUS

CRYSTAL STRUCTURE OF FLOCK HOUSE VIRUS stereo
Top of page
Black Beetle Virus (BBV)
Black Beetle Virus (BBV)

Black Beetle Virus (BBV) stereo
Top of page
Crystal structure of Flock House N363T mutant
Crystal structure of Flock House N363T mutant

Crystal structure of Flock House N363T mutant stereo
Top of page
Crystal structure of the D75N mutant capsid of Flock House virus
Crystal structure of the D75N mutant capsid of Flock House virus

Crystal structure of the D75N mutant capsid of Flock House virus stereo
Top of page
Flock House Virus Coat protein D75N mutant
Flock House Virus Coat protein D75N mutant

Flock House Virus Coat protein D75N mutant stereo
Top of page
CRYSTAL STRUCTURE OF THE AUTHENTIC FLOCK HOUSE VIRUS PARTICL
CRYSTAL STRUCTURE OF THE AUTHENTIC FLOCK HOUSE VIRUS PARTICL

CRYSTAL STRUCTURE OF THE AUTHENTIC FLOCK HOUSE VIRUS PARTICL stereo
Top of page
Flock House Virus
Flock House Virus

Flock House Virus stereo
Top of page
FHV VIRUS LIKE PARTICLE
FHV VIRUS LIKE PARTICLE

FHV VIRUS LIKE PARTICLE stereo
Top of page
Pariacoto Virus (PAV)
Pariacoto Virus (PAV)

Pariacoto Virus (PAV) stereo
Top of page
Crystal Structure of Flock House Virus calcium mutant
Crystal Structure of Flock House Virus calcium mutant

Crystal Structure of Flock House Virus calcium mutant stereo
Top of page
Canine Parvovirus
Canine Parvovirus

Canine Parvovirus stereo
Top of page
Canine Parvovirus Strain D
Canine Parvovirus Strain D

Canine Parvovirus Strain D stereo
Top of page
Canine Parvovirus Strain D, Mutant A300D
Canine Parvovirus Strain D, Mutant A300D

Canine Parvovirus Strain D, Mutant A300D stereo
Top of page
Mice Minute Virus (MVM), Strain I
Mice Minute Virus (MVM), Strain I

Mice Minute Virus (MVM), Strain I stereo
Top of page
Satellite Tobacco Mosaic Virus
Satellite Tobacco Mosaic Virus

Satellite Tobacco Mosaic Virus stereo
Top of page
CRYSTAL STRUCTURE OF AUTHENTIC PROVIDENCE VIRUS
CRYSTAL STRUCTURE OF AUTHENTIC PROVIDENCE VIRUS

CRYSTAL STRUCTURE OF AUTHENTIC PROVIDENCE VIRUS stereo
Top of page
CRYSTAL STRUCTURE OF PHYSALIS MOTTLE VIRUS WITH INTACT ORDERED RNA
CRYSTAL STRUCTURE OF PHYSALIS MOTTLE VIRUS WITH INTACT ORDERED RNA

CRYSTAL STRUCTURE OF PHYSALIS MOTTLE VIRUS WITH INTACT ORDERED RNA stereo
Top of page
Desmodium Yellow Mottle Virus (DYMV)
Desmodium Yellow Mottle Virus (DYMV)

Desmodium Yellow Mottle Virus (DYMV) stereo
Top of page
Structure of Turnip Yellow Mosaic Virus at 100 K
Structure of Turnip Yellow Mosaic Virus at 100 K

Structure of Turnip Yellow Mosaic Virus at 100 K stereo
Top of page
Images rendered with
Chimera
by Padmaja Natarajan
Last Modified : Tues Nov 8 11:58:20 PDT 2005


Main | Data & Analysis | Utilities | Search | Contact Us | Help | Links | Mailing List | Cite VIPERdb | Disclaimer

©1998-2016. TSRI. All rights Reserved.