
Ordered Portions of Nucleic Acid

This page is currently not being updated!

Sequences in red contain non-standard nucleotides.
Click on the virus name to see an image.
Virus Name



# Nucleotides


1. Alphaflexiviridae
Electron cryo-microscopy of filamentous flexible virus PepMV (Pepino Mosaic Virus)RNAB(UUUUU)B(5)5fn1
2. Bromoviridae
Cowpea Chlorotic Mottle Virus (CCMV)RNAR(AUAU), T(AU)R(4), T(2)1cwp
Tomato Aspermy VirusRNAR(AAA)R(3)1laj
3. Leviviridae
Bacteriophage MS2 Mutant (T59S)/RNA OperatorRNAR(ACAUGAGGAUUACCCAUGU)R(19)1aq3
Bacteriophage MS2 Mutant (T45A)/RNA OperatorRNAR(ACAUGAGGAUUACCCAUGU)R(19)1aq4
Bacteriophage MS2/RNA Hairpin (4One-5)RNAR(ACAUGAGGA(ONE)UACCCAUGU)R(19)1dzs
Bacteriophage MS2/RNA Hairpin (5Bru-5)RNAR(ACAUGAGGAUUACCCAUGU)R(19)1e6t
Bacteriophage MS2/RNA Hairpin (2One-5)RNAR(ACAUGAGGAU(PYO)ACCCAUGU)R(19)1e7x
Bacteriophage MS2/RNA Hairpin (C-7)RNAR(ACAUGAGGCUCACCCAUGU)R(19)1gkv
Bacteriophage MS2/RNA Hairpin (G-10)RNAR(ACAUCGCGAUUACGGAUGU)R(19)1gkw
Bacteriophage MS2/RNA Hairpin (G-5)RNAR(ACAUGAGGAUGACCCAUGU)R(19)1h8j
Bacteriophage MS2/RNA Hairpin (Ade-5)RNAR(ACAUGAGGAUAACCCAUGU)R(19)1he6
Bacteriophage MS2/RNA Hairpin (C-10)RNAR(ACAUGCGGAUCACCCAUGU)R(19)1kuo
Bacteriophage MS2/19 nt. MS2 RNA FragmentRNAR(ACAUGAGGAUCACCCAUGU)R(19)1zdh
Bacteriophage MS2/19 nt. MS2 RNA FragmentRNAR(ACAUGAGGAUUACCCAUGU)R(19)1zdi
Bacteriophage MS2/8 nt. MS2 RNA FragmentRNAR(GGAUCACC)R(8)1zdj
Bacteriophage MS2/23 nt. MS2 RNA FragmentRNAR(ACAUGAGGAUCACCCAUGU)R(19)1zdk
Bacteriophage MS2/RNA Aptamer F5RNAR(CCGGAGGAUCACCACGGG)R(18)5msf
Bacteriophage MS2/RNA Aptamer F6RNAR(CCACAGUCACUGGG), S(CAGUCACUGG)R(14), S(10)6msf
Bacteriophage MS2/RNA Aptamer F7RNAR(UCGCCAACAGGCGG)R(14)7msf
Bacteriophage MS2/RNA Aptamer F5 (2-aminopurine at -10 pos.)DNAR(CCGG(2PR)GGAUCACCACGG)R(17)1u1y
Bacteriophage MS2/RNA Hairpin (5bru-5) ComplexRNAR(CAUGAGGAU(5BU)ACCCAUG)R(17)2bu1
RNA stemloop from bacteriophage MS2 complexed with an N87S,E89K mutant MS2 capsidRNAS(ACAUGAGGAUUACCCAUGU)S(19)2b2e
RNA stemloop operator from bacteriophage QBETA complexed with an N87S,E89K mutant MS2 capsidRNAS(AUGCAUGUCUAAGACAGCAU)S(20)2b2d
MS2 Wild-type RNA stemloop complexed with an N87S mutant MS2 capsidRNAS(ACAUGAGGAUUACCCAUGU)S(19)2b2g
4. Microviridae
Bacteriophage α3DNAX(CCCC)X(4)1m06
Bacteriophage Φ-X 174DNAN(AAAAC)N(5)2bpa
Φ-X 174 DNA binding protein JDNAX(CAAA)X(4)1rb8
5. NA
6. Nodaviridae
Black Beetle Virus (BBV)RNAR(UCUUAUAUCU)R(10)2bbv
Flock House VirusRNAR(UCUUUUAUCU)R(10)fhv
Flock House Virus Coat protein D75N mutantRNAR(CCUCUUUUAUCU)R(12)2q25
Crystal structure of Flock House N363T mutantRNAR(CCUCUUUUAUCU)R(12)2q23
Crystal Structure of Flock House Virus calcium mutantRNAR(UUUAUCUP)R(8)3lob
Crystal structure of the D75N mutant capsid of Flock House virusRNAD(UUUCUCUUUUAUCUU)D(15)4fte
7. Parvoviridae
Canine Parvovirus Strain D, Mutant A300DDNAR(CCACCCCAA), S(AC)R(9), S(2)1ijs
Mice Minute Virus (MVM), Strain IDNAR(CCACCCCAACA), S(CAAA), T(A)R(11), S(4), T(1)1mvm
Canine ParvovirusDNAR(NTACCTCTTGC)R(11)1p5w
Canine Parvovirus Strain DDNAN(ATACCTCTTGC)N(11)4dpv
8. Picornaviridae
Rebuild and re-refined model for Human Parechovirus 1RNAD(GUUUUU)D(6)5m74
Rebuild and re-refined model for Human Parechovirus 1RNAD(GUUUUU)D(6)5mjv
9. Satellites
10. secoviridae
Bean Pod Mottle Virus, Middle ComponentRNAR(AGUCUC)R(6)1pgl
11. Tetraviridae
12. Tymoviridae
Desmodium Yellow Mottle Virus (DYMV)RNAR(UUUUUUU), S(UU)R(7), S(2)1ddl
Structure of Turnip Yellow Mosaic Virus at 100 KRNAD(CCC)D(3)2fz2
13. Unassigned
Low Resolution Structure of STNV complexed with RNARNAC(UUUU), B(AAA)C(4), B(3)3s4g
14. Virgaviridae
Cryo-EM Structure of TMV at 3.35A resolutionRNAR()R(0)4udv2
Cryo-EM structure of TMV at 3.35 A resolutionRNAR(GAA)R(3)4udv
Novel inter-subunit contacts in Barley Stripe Mosaic Virus revealed by cryo-EMRNAR(GAA)R(3)5a79
Novel inter-subunit contacts in Barley Stripe Mosaic Virus revealed by cryo-EMRNAR(GAA)R(3)5a7a
CryoEM Helical Reconstruction of TMVRNAR(AUG)R(3)3j06

Stereo pictures: (click images to enlarge)

Electron cryo-microscopy of filamentous flexible virus PepMV (Pepino Mosaic Virus)
Electron cryo-microscopy of filamentous flexible virus PepMV (Pepino Mosaic Virus)

Electron cryo-microscopy of filamentous flexible virus PepMV (Pepino Mosaic Virus) stereo
Top of page
Bamboo mosaic virus
Bamboo mosaic virus

Bamboo mosaic virus stereo
Top of page
Tomato Aspermy Virus
Tomato Aspermy Virus

Tomato Aspermy Virus stereo
Top of page
Cowpea Chlorotic Mottle Virus (CCMV)
Cowpea Chlorotic Mottle Virus (CCMV)

Cowpea Chlorotic Mottle Virus (CCMV) stereo
Top of page

Top of page

Top of page
Bacteriophage MS2/RNA Aptamer F5
Bacteriophage MS2/RNA Aptamer F5

Bacteriophage MS2/RNA Aptamer F5 stereo
Top of page
Bacteriophage MS2/RNA Hairpin (C-7)
Bacteriophage MS2/RNA Hairpin (C-7)

Bacteriophage MS2/RNA Hairpin (C-7) stereo
Top of page

Top of page

Top of page
Bacteriophage MS2/19 nt. MS2 RNA Fragment
Bacteriophage MS2/19 nt. MS2 RNA Fragment

Bacteriophage MS2/19 nt. MS2 RNA Fragment stereo
Top of page

Top of page
Bacteriophage MS2/RNA Aptamer F6
Bacteriophage MS2/RNA Aptamer F6

Bacteriophage MS2/RNA Aptamer F6 stereo
Top of page
Bacteriophage MS2/RNA Hairpin (G-10)
Bacteriophage MS2/RNA Hairpin (G-10)

Bacteriophage MS2/RNA Hairpin (G-10) stereo
Top of page

Top of page
Bacteriophage MS2/8 nt. MS2 RNA Fragment
Bacteriophage MS2/8 nt. MS2 RNA Fragment

Bacteriophage MS2/8 nt. MS2 RNA Fragment stereo
Top of page

Top of page
MS2 Wild-type RNA stemloop complexed with an N87S mutant MS2 capsid
MS2 Wild-type RNA stemloop complexed with an N87S mutant MS2 capsid

MS2 Wild-type RNA stemloop complexed with an N87S mutant MS2 capsid stereo
Top of page

Top of page

Top of page
Bacteriophage MS2/RNA Aptamer F7
Bacteriophage MS2/RNA Aptamer F7

Bacteriophage MS2/RNA Aptamer F7 stereo
Top of page
Bacteriophage MS2/RNA Hairpin (G-5)
Bacteriophage MS2/RNA Hairpin (G-5)

Bacteriophage MS2/RNA Hairpin (G-5) stereo
Top of page

Top of page
Bacteriophage MS2/23 nt. MS2 RNA Fragment
Bacteriophage MS2/23 nt. MS2 RNA Fragment

Bacteriophage MS2/23 nt. MS2 RNA Fragment stereo
Top of page
Bacteriophage MS2/RNA Hairpin (4One-5)
Bacteriophage MS2/RNA Hairpin (4One-5)

Bacteriophage MS2/RNA Hairpin (4One-5) stereo
Top of page

Top of page

Top of page

Top of page
Bacteriophage MS2 Mutant (T59S)/RNA Operator
Bacteriophage MS2 Mutant (T59S)/RNA Operator

Bacteriophage MS2 Mutant (T59S)/RNA Operator stereo
Top of page
Bacteriophage MS2/RNA Hairpin (Ade-5)
Bacteriophage MS2/RNA Hairpin (Ade-5)

Bacteriophage MS2/RNA Hairpin (Ade-5) stereo
Top of page
RNA stemloop from bacteriophage MS2 complexed with an N87S,E89K mutant MS2 capsid
RNA stemloop from bacteriophage MS2 complexed with an N87S,E89K mutant MS2 capsid

RNA stemloop from bacteriophage MS2 complexed with an N87S,E89K mutant MS2 capsid stereo
Top of page

Top of page
Bacteriophage MS2/RNA Hairpin (5Bru-5)
Bacteriophage MS2/RNA Hairpin (5Bru-5)

Bacteriophage MS2/RNA Hairpin (5Bru-5) stereo
Top of page
RNA stemloop operator from bacteriophage QBETA complexed with an N87S,E89K mutant MS2 capsid
RNA stemloop operator from bacteriophage QBETA complexed with an N87S,E89K mutant MS2 capsid

RNA stemloop operator from bacteriophage QBETA complexed with an N87S,E89K mutant MS2 capsid stereo
Top of page

Top of page
Bacteriophage MS2 Mutant (T45A)/RNA Operator
Bacteriophage MS2 Mutant (T45A)/RNA Operator

Bacteriophage MS2 Mutant (T45A)/RNA Operator stereo
Top of page
Bacteriophage MS2/RNA Aptamer F5 (2-aminopurine at -10 pos.)
Bacteriophage MS2/RNA Aptamer F5 (2-aminopurine at -10 pos.)

Bacteriophage MS2/RNA Aptamer F5 (2-aminopurine at -10 pos.) stereo
Top of page

Top of page
Bacteriophage MS2/RNA Hairpin (2One-5)
Bacteriophage MS2/RNA Hairpin (2One-5)

Bacteriophage MS2/RNA Hairpin (2One-5) stereo
Top of page

Top of page

Top of page
Bacteriophage MS2/RNA Hairpin (5bru-5) Complex
Bacteriophage MS2/RNA Hairpin (5bru-5) Complex

Bacteriophage MS2/RNA Hairpin (5bru-5) Complex stereo
Top of page
Bacteriophage MS2/RNA Hairpin (C-10)
Bacteriophage MS2/RNA Hairpin (C-10)

Bacteriophage MS2/RNA Hairpin (C-10) stereo
Top of page

Top of page

Top of page
Bacteriophage MS2/19 nt. MS2 RNA Fragment
Bacteriophage MS2/19 nt. MS2 RNA Fragment

Bacteriophage MS2/19 nt. MS2 RNA Fragment stereo
Top of page

Top of page
Bacteriophage α3
Bacteriophage α3

Bacteriophage α3 stereo
Top of page
Bacteriophage Φ-X 174
Bacteriophage Φ-X 174

Bacteriophage Φ-X 174 stereo
Top of page
Φ-X 174 DNA binding protein J
Φ-X 174 DNA binding protein J

Φ-X 174 DNA binding protein J stereo
Top of page

Top of page

Top of page

Top of page
Flock House Virus Coat protein D75N mutant
Flock House Virus Coat protein D75N mutant

Flock House Virus Coat protein D75N mutant stereo
Top of page
Crystal structure of the D75N mutant capsid of Flock House virus
Crystal structure of the D75N mutant capsid of Flock House virus

Crystal structure of the D75N mutant capsid of Flock House virus stereo
Top of page
Flock House Virus
Flock House Virus

Flock House Virus stereo
Top of page
Black Beetle Virus (BBV)
Black Beetle Virus (BBV)

Black Beetle Virus (BBV) stereo
Top of page
Crystal Structure of Flock House Virus calcium mutant
Crystal Structure of Flock House Virus calcium mutant

Crystal Structure of Flock House Virus calcium mutant stereo
Top of page
Pariacoto Virus (PAV)
Pariacoto Virus (PAV)

Pariacoto Virus (PAV) stereo
Top of page

Top of page
Crystal structure of Flock House N363T mutant
Crystal structure of Flock House N363T mutant

Crystal structure of Flock House N363T mutant stereo
Top of page
Mice Minute Virus (MVM), Strain I
Mice Minute Virus (MVM), Strain I

Mice Minute Virus (MVM), Strain I stereo
Top of page
Canine Parvovirus
Canine Parvovirus

Canine Parvovirus stereo
Top of page
Canine Parvovirus Strain D, Mutant A300D
Canine Parvovirus Strain D, Mutant A300D

Canine Parvovirus Strain D, Mutant A300D stereo
Top of page
Canine Parvovirus Strain D
Canine Parvovirus Strain D

Canine Parvovirus Strain D stereo
Top of page

Top of page

Top of page
Rebuild and re-refined model for Human Parechovirus 1
Rebuild and re-refined model for Human Parechovirus 1

Rebuild and re-refined model for Human Parechovirus 1 stereo
Top of page
Rebuild and re-refined model for Human Parechovirus 1
Rebuild and re-refined model for Human Parechovirus 1

Rebuild and re-refined model for Human Parechovirus 1 stereo
Top of page

Top of page

Top of page

Top of page

Top of page

Top of page
Bean Pod Mottle Virus, Middle Component
Bean Pod Mottle Virus, Middle Component

Bean Pod Mottle Virus, Middle Component stereo
Top of page

Top of page

Top of page
Desmodium Yellow Mottle Virus (DYMV)
Desmodium Yellow Mottle Virus (DYMV)

Desmodium Yellow Mottle Virus (DYMV) stereo
Top of page
Structure of Turnip Yellow Mosaic Virus at 100 K
Structure of Turnip Yellow Mosaic Virus at 100 K

Structure of Turnip Yellow Mosaic Virus at 100 K stereo
Top of page
Low Resolution Structure of STNV complexed with RNA
Low Resolution Structure of STNV complexed with RNA

Low Resolution Structure of STNV complexed with RNA stereo
Top of page
Cryo-EM Structure of TMV at 3.35A resolution
Cryo-EM Structure of TMV at 3.35A resolution

Cryo-EM Structure of TMV at 3.35A resolution stereo
Top of page
Novel inter-subunit contacts in Barley Stripe Mosaic Virus revealed by cryo-EM
Novel inter-subunit contacts in Barley Stripe Mosaic Virus revealed by cryo-EM

Novel inter-subunit contacts in Barley Stripe Mosaic Virus revealed by cryo-EM stereo
Top of page
Novel inter-subunit contacts in Barley Stripe Mosaic Virus revealed by cryo-EM
Novel inter-subunit contacts in Barley Stripe Mosaic Virus revealed by cryo-EM

Novel inter-subunit contacts in Barley Stripe Mosaic Virus revealed by cryo-EM stereo
Top of page
CryoEM Helical Reconstruction of TMV
CryoEM Helical Reconstruction of TMV

CryoEM Helical Reconstruction of TMV stereo
Top of page
Cryo-EM structure of TMV at 3.35 A resolution
Cryo-EM structure of TMV at 3.35 A resolution

Cryo-EM structure of TMV at 3.35 A resolution stereo
Top of page
Images rendered with
by Padmaja Natarajan
Last Modified : Tues Nov 8 11:58:20 PDT 2005

Main | Data & Analysis | Utilities | Search | Contact Us | Help | Links | Mailing List | Cite VIPERdb | Disclaimer

©1998-2019. TSRI. All rights Reserved.